                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:101 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttcat-cataat. It has a score value of 63.59 and is shown in blue

tttcattaaagatccctgtctttcataatttaatagaacttatgctcagcgtagctaggtatgggtaatgttttatgagagcagaaacataagtttattt
tgacgcagatcatttaaataaacaaaatcttgcagcgggattatccgccgcaagattatttcttttcggtaattttcaatcagaggagaatctctgattg
catgtttgaatcctgtttatataatctataagctgtctctagatacttaatgaaaatagaggggttTTG

    CCA00619 Gene: CCA00619     GI: 29840377     BI number: CCA00619     GOG: -------     Description: conserved domain protei           tt          a  a          g  t           gc           gc           cg           gc          a  c           cg           gc           ta           ta           cg           ta           at           at             atttcttttcggtaattttcaatcagaggagaatctctgattgcatgtttgaatcctgtttatataatctataagctgtctctagatacttaatgaaaatagaggggttTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:190 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-10.40 kcal/mol Antiterminator: Size=68 nt.     Delta G=-18.11 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G= -9.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCTCCCGTAGAGCTCCGTGCTGAGTAAggcggtctttcattaaagatccctgtctttcataatttaatagaacttatgct cagcgtagctaggtatgggtaatgttttatgagagcagaaacataagtttattttgacgcagatcatttaaataaacaaaatcttgcagcgggattatcc gccgcaagattatttcttttcggtaattttcaatcagaggagaatctctgattgcatgtttgaatcctgtttatataatctataagctgtctctagatac ttaatgaaaatagaggggttTTG     CCA00619 Gene: CCA00619     GI: 29840377     BI number: CCA00619     GOG: -------     Description: conserved domain protei            at           c  t            ta            ta            ta            cg            ta            gt            gc           c  |            gc            gc            At           |  g           |  t           |  c           |  t ag       |  t g  g      |  t a  g      |  c tg       |  a at       |  t at       |  a aT       |  a aT       |  t |  G      |  t g  T      |  t t  G      |  a a  C      |  a aT       |  t tG       |  a tA       |  g cG       |  a        t aT       |  a      g  a tA       |  c       cg a  |      |  t       gc g  |      |  t       at a  |      |  a      c  a t  |       At       t  g c  |       Tg        cg tA        Gc        gt cg        At        ta tg        Gc        at gc        Ta        tg tg        Cg        tg cg        Gc        cg gt        Tg        at                         aatgttttatgagagcagaaacataagtttattttgacgcagatcatttaaataaacaaaatcttgcagcgggattatccgccgcaagattatttcttttcggtaattttcaatcagaggagaatctctgattgcatgtttgaatcctgtttatataatctataagctgtctctagatacttaatgaaaatagaggggttTTG     ..................................................................................................................