                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTTTGGCATTTTCTCTGGGATCAGCTTTATTGACCTTTGCTGTTACATCCGTGGTT
TTGAGGCAGGGTGAGTTGCGACGTGAGAGATGCTGGAGAAGTCATGCGCTGCGTTGGA
ATTCCTTCGCAAATGATTTGTATACTGCTCTTGAAACGGCGAGGCAAAAAAGAAGTCC
GCGATTACCTTCTTCTGTAAGTGCGCAATCTTGTTAAacagctaattattttttattagcacgtatttatttg
cgtaccttaaggtattttgcaagaatttttattatcgatatattgggtgttttATG

    CCA00621 Gene: CCA00621     GI: 29840379     BI number: CCA00621     GOG: -------     Description: conserved domain protei tt t  t a  t t  t ta at at ta cg gc a  a c  | a  | A  | A  | T  | T  | G  | T  |                 ta T  |                t  a C  |                 cg T  |                 cg A  |                 at A  |                 ta C  |                 gt Gc        ta       |  t Cg       t  t      |  t Gt       t  t      |  t Ta        at        cg Gt        tg        gc At        gc        ta At        cg        ta Ta        at        tg                         aatttttattatcgatatattgggtgttttATG     ..................................................................................................................