                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-15.09 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGGAATTCTCGATCCAACTAAAGTTACACGTTGTGCTTTAGAAAGCGCAGCTTCTG
TAGCTGGGCTTCTATTAACAACAGAAGCTTTAATTGCCGATATTCCTGAAGAGAAATC
CTCTTCTGCTCCCGCAATGCCAGGCGCAGGAATGGATTATTAAtccttaatttagagagcattttctc
taatattataaggtctcctttcatccatcttgagaagaaagggggccttttttattttctaatatttctttcttcatctatgttggaaaccaagataaat
catattctcatcatgcATG

   ف Gene: CCA00644     GI: 29840402     BI number: CCA00644     GOG: NOG05406     Description: conserved hypothetical protei at c  t gt at gc at gc at ta ta |  t |  a |  t t  t a  a at ta ta cg cg |  t       ct |  c      t  t t  t      a  g A  c      c  a A  c       cg T  t       ta T  t      a  a A  t       cg T  c       ta Ta        ta At        ta Gc        cg Gc        cg Ta        tg At        cg             gccttttttattttctaatatttctttcttcatctatgttggaaaccaagataaatcatattctcatcatgcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_caviae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.20 kcal/mol Antiterminator: Size=65 nt.     Delta G=-15.09 kcal/mol Anti-antiterminator:   Size=29 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCAGGAATTCTCGATCCAACTAAAGTTACACGTTGTGCTTTAGAAAGCGCAGCTTCTG TAGCTGGGCTTCTATTAACAACAGAAGCTTTAATTGCCGATATTCCTGAAGAGAAATC CTCTTCTGCTCCCGCAATGCCAGGCGCAGGAATGGATTATTAAtccttaatttagagagcattttctc taatattataaggtctcctttcatccatcttgagaagaaagggggccttttttattttctaatatttctttcttcatctatgttggaaaccaagataaat catattctcatcatgcATG    ف Gene: CCA00644     GI: 29840402     BI number: CCA00644     GOG: NOG05406     Description: conserved hypothetical protei            ta           a  a            tg            tg            at            tc            at            ac            tc            ct           |  t           |  t           |  c           t  a           c  t            tc            tc            ta        ct            tt       t  t            ac       a  g at       |        c  a c  t      |         cg gt       c         ta at       g        a  a gc       a         cg at       g         ta gc       a         ta at       g         ta ta       a         cg ta        t        cg |  t       t        tg ta        t        cg at        a        tg at        a        gc ta        t        gc                         ttttttattttctaatatttctttcttcatctatgttggaaaccaagataaatcatattctcatcatgcATG     ..................................................................................................................