                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:121 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -6.40 kcal/mol
Antiterminator:    Distance from promoter:73 nt. Size=43 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttcct-taatgt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttcctttcacatccctcttttttaatgttattttctatatttcacatgattttctcacaaaatttcatgccgttttctagagcagtttcatgccatttt
tctaacctaactcatttataatgtttgacattggggggggggttaatatcgcccggtttttaaaaacttgttattgatttcatgagactaataaccagtg
tgacaaccgcaggcaactcagcaatcggggaattgtaagggttaacttagtctctcaaaacatttttattataggagattttATG

    CCA00702 Gene: CCA00702     GI: 29840460     BI number: CCA00702     GOG: NOG47502     Description: hypothetical protei   t t  g t  a gc ta at at tg a  g t  | t  | t  | a  | cg tg cg        aa a  g      t  t a  g       ta tg        gt cg        gc cg       g  g at        gc at        gc ta        gc             ggtttttaaaaacttgttattgatttcatgagactaataaccagtgtgacaaccgcaggcaactcagcaatcggggaattgtaagggttaacttagtctctcaaaacatttttattataggagattttATG     ..................................................................................................................