                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:48 nt. Size=30 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=53 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcgct-cataat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgctaatattttaattcaaaacataataatttcacaattaggggtttatggtttttttgattaaaaaaataattcgcacccattttggttaagtttcc
tttgtgcatcctaaagaggatgtattttttaattcagaaattgacaagagtaagtataaagctacagaatagtgccgaaacatcggatagcatataggag
agaagtATG

    CCA00706 Gene: CCA00706     GI: 29840464     BI number: CCA00706     GOG: COG1268     Description: conserved hypothetical protei at g  t ta ta ta ta ta ta ta gt g  a       ag ta       a  t at       t  t t  t      t  t t  c       gc tg        gc gc       t  t       aa |  a      t  t      a  g gc       t  t       ta gc       t  |       cg gc       a  |       cg a  a      c  |       ta t  t      c  |       at t  t       cg        cg at        at        gt at        cg        ta cg        gc        gt                         tttttaattcagaaattgacaagagtaagtataaagctacagaatagtgccgaaacatcggatagcatataggagagaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1268 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................