Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-22.80 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=35 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:    Distance from promoter:14 nt.    Size=49 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCAA-TATAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAAAAAAAGAGGTTACAAAAATTATAATAATTGCTTTGTTGGCGTTATTAGCGAT
TTTTCTTTTTTCTACGGAGAAAATTCGTCTATAAcgatcccaatcaccctttgggaggggccttcgggtccctct
cattttttctttagttctcattctttttctctcacattcccttctgttatttaatgtattattttcttattcttaggagatagagaagagttcttaatac
atcctcgatttcaaggtaaacgtATG

    CCA00732


Gene: CCA00732     GI: 29840489     BI number: CCA00732     GOG: COG0665     Description: oxidoreductase, DadA famil


  C
T  T
T  A
T  C
 TG         c
 TG       a  c
 TA       c  c
 CG       t  t
 TA        at
 TA        at
 TA        cg
 TA        cg
T  T       cg        tc
 AT        ta       t  g
 GC       a  g       cg
 CG       g  |       cg
 GT       c  |       gt
A  C      A  |       gc
T  T      A  |       gc
 TA       T  |       gc
 AT       A  |       at
 TA        Tg        gc
 TA        Cg        gt
 Gc        Tg        gc
 Cg        Gc        ta
                        ttttttctttagttctcattctttttctctcacattcccttctgttatttaatgtattattttcttattcttaggagatagagaagagttcttaatacatcctcgatttcaaggtaaacgtATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here

    ..................................................................................................................