                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=44 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-CAAACT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGACTCGCGTAACGGAATACCAAACTTCTGGGAACTTAAGCTGGTAGtccttatctgaaa
tagtttttatagatattttgacgactttcagtaatctctgaaagtcatttttttatatctaggaatcgtttttaatcttttttctcttgaaaagaaaatc
cttagagaaaactgaaagagcttttataatttcctgagatataagttcttattattatttcacaATG

    CCA00775 Gene: CCA00775     GI: 29840532     BI number: CCA00775     GOG: COG0220     Description: conserved hypothetical protein TIGR0009   t a  a g  t a  t t  t at tg ta t  c tg ta gc at        at t  |      a  c a  |      t  t at        gc at        at gc        cg ta        ta cg        ta t  |       ta at        cg ta        at ta        gc             atttttttatatctaggaatcgtttttaatcttttttctcttgaaaagaaaatccttagagaaaactgaaagagcttttataatttcctgagatataagttcttattattatttcacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0220 Predicted S-adenosylmethionine-dependent methyltransferase ... can be seen here     ..................................................................................................................