                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=28 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attgcgtatctaagtggaaaaaatgctcctcagaagcggatttttttccagagaatgagactacttttcaattgcacgaaacgctgtctattcctatata
tggtatacaagcacataatgtttcactacatattgggttttctggaagaaacgtcttctggagaagggagagctttctctaagttttttgatcttcaatt
acgaaagttcgtcttaacttttcctaagtgtttagccgaattctattattgcttggaaatacttatttgaatcgaaaatacagctgttaggggatgacat
ATG

    nrdA --- nrdB Gene: nrdA     GI: 29840534     BI number: CCA00777     GOG: COG0209     Description: ribonucleoside-diphosphate reductase, alpha subunit Gene: nrdB     GI: 29840533     BI number: CCA00776     GOG: COG0208     Description: ribonucleoside-diphosphate reductase, beta subuni   t a  a c  a at cg gt at at c  c a  a t  c a  t t  a g  | gc ta at ta at t  |       ac at       a  g tg        at         g cg        gc       a  a cg        at       g  g |  t       at        gc |  t       gc        gt |  t      g  t       at t  t      t  g       at t  c       cg        gc at        ta        at tg        tg        gc cg        ta        gt ta        ta        ta                         agttttttgatcttcaattacgaaagttcgtcttaacttttcctaagtgtttagccgaattctattattgcttggaaatacttatttgaatcgaaaatacagctgttaggggatgacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0209 Ribonucleotide reductase, alpha subunit ... can be seen here [F] COG0208 Ribonucleotide reductase, beta subunit ... can be seen here     ..................................................................................................................