Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGCTAATAACATTTTAGGATCTCCCACAGATCAACAAAATGTCGCGTATATGGTT
ATGGACGAAGGCAATGCAGATGATGAAGCAAGTACTTCTTCAGAACGCGAATCTCCTA
GATAAttttttaatcatgagggtgttaaaggagggcttcttatctgagctagggagctctttttcttgttgtatattaggggaaaaaattgagatta
agttgttggttttcttaattttaagaacaaacagcttgatattaacacattaagtgtattgaatgtctgcgtcttattttatttagaATG

    CCA00794 --- CCA00793


Gene: CCA00794     GI: 29840551     BI number: CCA00794     GOG: COG0419     Description: hypothetical protein
Gene: CCA00793     GI: 29840550     BI number: CCA00793     GOG: -------     Description: hypothetical protei


 ag
g  g
 tg
 at
 cg
t  |
 at
 at
 ta
 ta
 ta
 tg
 tg         g
 ta       t  a
|  g      c  g
|  g      t  c
|  g       at
|  c       ta
|  t       tg
|  t       cg
|  c       tg
 At        ta
 At        cg
 Ta        gc
 At        gt
 Gc        gc
 At        at
 Tg        gt
            tttcttgttgtatattaggggaaaaaattgagattaagttgttggttttcttaattttaagaacaaacagcttgatattaacacattaagtgtattgaatgtctgcgtcttattttatttagaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0419 ATPase involved in DNA repair ... can be seen here

    ..................................................................................................................