                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACTGTTGAAGCTACAGAAGAAGTAGAAGCTTCTGAAGAAGGAGATTCTGTACATGC
AGGGAACCTAGACAGTGAAAGTGGTCCAGACCTTGATTAAtttggatggatacttatgaaataaaaggct
gtgactgtatgtttacagccctttaaattaataatgtcagttttattgaccctattcaatagggtcgctttttataagcattagttcaatagccacgcat
tttatgagttgtttcataaggtgctttgttctctttttctccttcttagatatctagaaacacataaatgtaTTG

    CCA00796 Gene: CCA00796     GI: 29840553     BI number: CCA00796     GOG: -------     Description: hypothetical protei   t t  t ta gt         c at       t  a cg        ta ta        at gc        ta t  c       cg a  c       cg at        cg ta        at at        gc at        tg             ctttttataagcattagttcaatagccacgcattttatgagttgtttcataaggtgctttgttctctttttctccttcttagatatctagaaacacataaatgtaTTG     ..................................................................................................................