Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:120 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -9.90 kcal/mol
Antiterminator:    Distance from promoter:105 nt. Size=16 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:58 nt.    Size=56 nt.     Delta G=-11.66 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGATG-TACAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATGTCACACGTCATCTAGATTATACAATTTATCCCGGCTCAATGGTCTGTGGGCT
GTCTAAGCTTGTAATAAAGTGTCATGGGAAAGCTTGCGGAAAATCTTTATTTAATGGC
ATTTCCGGATCTATAGATTTAGCGCGTGCACGTGTTTGTGAGCGCATTTTATCTAGTT
TATCTTAAtctttaagtttgtctatttcacctctttctctattgacgggatcgtattgatagtgataaaccttttgaaaacgaacactgaaata
tctctgaattaggtttacgATG

    CCA00806


Gene: CCA00806     GI: 29840563     BI number: CCA00806     GOG: NOG05022     Description: polymorphic outer membrane protein D family protein/autotransporte


  T
A  T
C  T
 GC
 GC
 TG
A  G
A  A
T  T
T  C
T  T
A  A
T  T
T  |
 TA
 CG
 TA                  GT
 AT                 T  T
 AT                  GT
 AT                  CG
A  A                 AT
G  G       GC        CG
 GC       T  A      G  A
 CG        GC       T  |
 GC        CG       G  |
 TG        GT        CG
T  T       CG        GC
 CG        GT        CG
 GC        AT        GC
                        ATTTTATCTAGTTTATCTTAAtctttaagtttgtctatttcacctctttctctattgacgggatcgtattgatagtgataaaccttttgaaaacgaacactgaaatatctctgaattaggtttacgATG


    ..................................................................................................................