                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:171 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-21.30 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=31 nt.     Delta G=-10.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -5.54 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-TATGTT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTATGGTGGTGGCGCAAATTATGTTAAGAAAATCCAAGCTGCTTTGAAGCAAAA
ATAGtaaatctcttcttgaagaattttagagaggagatcttcctctctgaagttctcttttctcttaaTTAAACATTCATCTTTT
TTATTGTTTTTGAGAAAATCTCTATCTTACAGTGAACTTTTAATACCACTTTCTTCAG
ATAGCATCGAGTTTTTTGCATCGTGGTTTGCATTTTCGAAAGCAACGCACTCTTTGAA
GAATAAGAAATAGGCAAAAGGATTTAGAAAAAATG

    lysS Gene: lysS     GI: 29840596     BI number: CCA00839     GOG: COG1190     Description: lysyl-tRNA synthetas AG A  C G  A TA TA TA C  A                  t GT                 a  c TA                  gt CG         a        at Gt       a  t       gc A  a      g  t       gc A  a      a  t       at C  a      a  t       gc C  t      g  a       at T  c       tg        gc A  t       ta        at A  c       cg        tg At        ta        ta At        tg        ta Gc        cg        tg At        ta        at At        cg        at Tg        ta        gc Ta        at        at                         cttttctcttaaTTAAACATTCATCTTTTTTATTGTTTTTGAGAAAATCTCTATCTTACAGTGAACTTTTAATACCACTTTCTTCAGATAGCATCGAGTTTTTTGCATCGTGGTTTGCATTTTCGAAAGCAACGCACTCTTTGAAGAATAAGAAATAGGCAAAAGGATTTAGAAAAAATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1190 Lysyl-tRNA synthetase (class II) ... can be seen here     ..................................................................................................................