                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAAATAAGTATTCAAGAATTACCGGATCAATTTCAGCTACATGATTTGATAAAAA
CAGGCTGCCTTGATTGGGATTGGGTTTGAGAGACTTTAAACCCTCTAGTTTTATCTTG
TAGCGCAATTTTAAGGCAAAGCCAACGAGAGATGCATAGGTAGTTTCATAGATAGTGC
GCCACATCTTAACTATCATaggtaaccttttcccataacaaattctcttacaacccctctagtaagtttaacataatcccggcttt
tgatagtatggtttagctattacttaggaaaaaaatcactATG

    CCA00849 Gene: CCA00849     GI: 29840606     BI number: CCA00849     GOG: COG1218     Description: 3'(2'),5'-biphosphate phosphatase nucleotidas TA C  C G  A AT CG TA T  T T  | AT AT CG TA AT |  A                 GA |  A                A  C |  A                 GT |  A        A        AT |  A      G  T       GT G  C      T  T       TA G  A       TG        TA CG        CG        TA CG        CG        GC A  C      |  A       GC T  T      |  T       GC T  G      |  T      T  | A  C      G  G      T  | A  |       TG       A  | GC        CG        GT AT        GT        GC AT        GT        GT CG        AT        TA TA        CG        TG                         TTTTATCTTGTAGCGCAATTTTAAGGCAAAGCCAACGAGAGATGCATAGGTAGTTTCATAGATAGTGCGCCACATCTTAACTATCATaggtaaccttttcccataacaaattctcttacaacccctctagtaagtttaacataatcccggcttttgatagtatggtttagctattacttaggaaaaaaatcactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1218 3'-Phosphoadenosine 5'-phosphosulfate (PAPS) 3'-phosphatase ... can be seen here     ..................................................................................................................