Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:170 nt.    Distance to gene:27 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:151 nt. Size=24 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGATT-AATAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGATTCTCAGAAGTTTCCGCAATAATTCAGTCCTTATGTTCTTATGATGTTCCAGAA
ATCCTTTTGGTTAAAGTTGATGATGGAAATCCGCAGTATTTACAGTGGTTATCTCTAG
AAACGGCCCCACAAATACCTCAGGAATGAataaatcttgacgttatttagaaaatcgatataatctcttccggaacttt
gagggatacataagtatctcattctttttctccacacctcaatttaatttggattttATG

    CCA00862


Gene: CCA00862     GI: 29840619     BI number: CCA00862     GOG: COG1837     Description: KH domain protei



 aa
g  c
g  t
c  t       ta
c  t      a  a
 tg        cg
 ta        at
 cg        ta
 tg        at
 cg        gc
 ta        gt
 at        gc
            attctttttctccacacctcaatttaatttggattttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1837 Predicted RNA-binding protein (contains KH domain) ... can be seen here

    ..................................................................................................................