                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -4.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAATCCCCTGCAAAAAAGACCTCAGCTAAAGCAAAAGCCAAAAAAAATTCTTCTCG
CTCCCTAAGAAAATAAttttttccttatttcgggtttcagagggtaattatatttataacttgccctcattttttctctcctcttccc
ttcttaaaagactatcccaagaaacccttccttatgataaaattttgcagtaattttatctgcaaaggatcatattcccattacattcttgcaggtatgt
gacacgtctcacataaaatcctactttaaatagaaacctttataaaggtgggtcATG

    CCA00883 Gene: CCA00883     GI: 29840640     BI number: CCA00883     GOG: COG2265     Description: RNA methyltransferase, TrmA family, putativ   g g  g c  t t  t t  t t  c a  a tg ta cg cg        tt tg       a  t t  t       ta t  |       at t  |       ta ta        ta ta       |  c At        at At        at Ta        tg At        gc A  a       gc At        gc At        at Gt        gc             attttttctctcctcttcccttcttaaaagactatcccaagaaacccttccttatgataaaattttgcagtaattttatctgcaaaggatcatattcccattacattcttgcaggtatgtgacacgtctcacataaaatcctactttaaatagaaacctttataaaggtgggtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2265 SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase ... can be seen here     ..................................................................................................................