                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:75 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -8.20 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=42 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=55 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggat-taatat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggataaatattatcgtcgagataatattttcccttagctttcatggcttatggcgaacgtagctcagttggttagagcgtcggattgtggttccgaag
gtcgcgggttcaagccccgtcgttcgcccttctttatcttctttgtttcttttgcaattcttgctataaccaaatattagaataaattctcactctacta
aaaaccttgtgtctattcATG

    CCA00887 --- CCA00888 --- CCA00889 Gene: CCA00887     GI: 29840643     BI number: CCA00887     GOG: COG1674     Description: cell division protein FtsK, putative Gene: CCA00888     GI: 29840644     BI number: CCA00888     GOG: COG1235     Description: metal dependent hydrolase, putative Gene: CCA00889     GI: 29840645     BI number: CCA00889     GOG: COG2940     Description: SET domain protei   c a  g a  t g  a cg gc |  t gc         t ta       g  g |  g      t  g a  t      t  t t  t       at tg        gc cg        gc gt        cg         a gt        ta       c  a ta       |  a      t  g a  |      |  g      t  c c  |      |  g       gc t  |      |  t       gc tg        gc        gc ta        cg        cg cg        gc       |  t gc       a  g       gc a  g      g  g       cg t  t      a  g      |  t t  c      t  t      |  t c  |      t  |      |  c cg        gt        tg cg        gc        gc ta        ta        gc                         cttctttatcttctttgtttcttttgcaattcttgctataaccaaatattagaataaattctcactctactaaaaaccttgtgtctattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1674 DNA segregation ATPase FtsK/SpoIIIE and related proteins ... can be seen here [R] COG1235 Metal-dependent hydrolases of the beta-lactamase superfamily I ... can be seen here [R] COG2940 Proteins containing SET domain ... can be seen here     ..................................................................................................................