                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTATCGAAAATCTTGAAGGAAATATCGTAACGATTGCCTATGCAGGAAATTGTTCTGG
ATGTTTTTCCGCAATAGGATCTACATTGAATTCTATAGGCCAGCTCTTACGCGCCTAC
GTTTATTCCGAATTGCAAATTAAAGTAAATGAGGCCTCTTTAGATTTTTCTACGTCTC
AACACTCCGAAGAAACTAATTAActttcattgttagtgaattgtcaataattcacatcttttgataaagaatgatgaaatgtt
aataaccctataattatttcattattttttcttgaggattgttGTG

    CCA00907 --- CCA00908 --- CCA00909 --- CCA00910 --- CCA00911 --- gpdA Gene: CCA00907     GI: 29840662     BI number: CCA00907     GOG: COG1536     Description: secretory protein, YscJ/FliF family Gene: CCA00908     GI: 29840663     BI number: CCA00908     GOG: NOG06350     Description: conserved hypothetical protein Gene: CCA00909     GI: 29840664     BI number: CCA00909     GOG: COG1157     Description: virulence factor transport ATPase, putative Gene: CCA00910     GI: 29840665     BI number: CCA00910     GOG: NOG09595     Description: conserved hypothetical protein Gene: CCA00911     GI: 29840666     BI number: CCA00911     GOG: COG4284     Description: UTP--glucose-1-phosphate uridylyltransferase family protein Gene: gpdA     GI: 29840667     BI number: CCA00912     GOG: COG0240     Description: glycerol-3-phosphate dehydrogenase, NAD-dependen            CA           A  T           T  T            CG            TA           |  A            AT            GT            GC            AT            TA            AT           A  A           C  |           G  | AA        CG        TT C  T       CG       C  A G  A      T  C      T  C CG       T  C       CG CG       T  |       GC TA        TA       A  | T  T       TG       C  | T  C       GC        CG T  T      T  |       GC TA        AT        GC GC        GC        AT TA        GT        TA                         CGTTTATTCCGAATTGCAAATTAAAGTAAATGAGGCCTCTTTAGATTTTTCTACGTCTCAACACTCCGAAGAAACTAATTAActttcattgttagtgaattgtcaataattcacatcttttgataaagaatgatgaaatgttaataaccctataattatttcattattttttcttgaggattgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1536 Flagellar motor switch protein ... can be seen here [NU] COG1157 Flagellar biosynthesis/type III secretory pathway ATPase ... can be seen here [G] COG4284 UDP-glucose pyrophosphorylase ... can be seen here [C] COG0240 Glycerol-3-phosphate dehydrogenase ... can be seen here     ..................................................................................................................