                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTATTTGGAGGTGGGAGCATTAAATGTTGGTTCCATTGTTCAGACCTACACGGCAGAA
AAAAAGTATTCTAAAGGCAATGAGAAGGGCTTTTTTGAAATCGGAGGGTCTACTGTAA
TCGTGTTGTTTGAACCAGGAGTTATTCAGTTTGACGCAGACTTATTGAAGAACTCGCG
GATGGGATTAGAAACACGTTGCCTTATGGGGCAGTCTTTAGGGCGTTCTTTGAGAGAA
TAAttttaaagactttaaaggttttttttggtattgcaaagagagagaaaagtgcaaattggcgaattATG

    CCA00926 Gene: CCA00926     GI: 29840681     BI number: CCA00926     GOG: COG0457     Description: conserved hypothetical protei            CA           G  G            GT            GC            GT AT       T  T T  G       AT TG        TA CG        TG CG        CG GC        CG TA        GC TG        TG             TTCTTTGAGAGAATAAttttaaagactttaaaggttttttttggtattgcaaagagagagaaaagtgcaaattggcgaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................