                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGTCTTTAGGGCTTTTTGTCTATGCAGGACCTTTTGTTCGTTCTAGTTTCAATGC
AGATATCGTCTTGCATAATCTGGAGAACAAACAATCTGATGTAGCAAAAATGCAGAAT
TAGtctgcatttgctttgtttacattcgtcttttttagatataaacttgtataactataacgttattaaaagagtttccatcgtcacatatagataga
aatcagaaacatatttattgtttaatgttcacgattggcactaatccccccttttgttatggtgagtaaaaaggtatgcgtgggttATG

    sctJ --- CCA00936 Gene: sctJ     GI: 29840690     BI number: CCA00935     GOG: COG4669     Description: type III secretion protein SctJ Gene: CCA00936     GI: 29840691     BI number: CCA00936     GOG: NOG04995     Description: conserved hypothetical protei   T A  C TG AT GC |  T AT CG GC        AA TA       C  A AT       A  C        T A  A      A  A      T  A C  A      G  A      A  G T  T       AT        At T  |       GC        Gc T  |       GT        At GC       T  |       Cg AT        CG        Gc TG        TA        Ta CG        AT        At TA       A  G      A  | T  |      T  T      A  | G  |      A  A       At CG        CG        At TA        GC        Cg TA        TA        Gc GC        TA        At                         ttgtttacattcgtcttttttagatataaacttgtataactataacgttattaaaagagtttccatcgtcacatatagatagaaatcagaaacatatttattgtttaatgttcacgattggcactaatccccccttttgttatggtgagtaaaaaggtatgcgtgggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG4669 Type III secretory pathway, lipoprotein EscJ ... can be seen here     ..................................................................................................................