                                                                        Gene putatively regulated by attenuation in C_caviae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTCGGTCCTGAAGGACTATTTAAAGATTCTAATCCATTTTCTGGAGAATAGaatcgccta
cagatcgctttctagaaataactagaaagcgattgtctttttattctaacaacacttctgcactacccatctgatctcttttagacaagctatacagata
gataaactctcttggtgcattaaatagtagatgtctgcttaagcaaaattttctatatacttaagaaatgaagaaagagggcatatgacgatcaaaatga
tctttcatatcctatcttataactactgatttaatgtagATG

    CCA00964 --- CCA00965 Gene: CCA00964     GI: 29840719     BI number: CCA00964     GOG: COG2208     Description: regulatory protein, putative Gene: CCA00965     GI: 29840720     BI number: CCA00965     GOG: NOG04997     Description: conserved hypothetical protei             t           c  a           c  c           g  a       at            cg       a  a   T        ta       a  a T  T      a  |       gc T  C       at        at AT        Gc        ta CG       A  g       cg CG       T  c       ta TA       A  |       ta |  G       At        ta |  A       Gt        cg A  A       At        gc AT        Gc        cg TA        Gt        ta CG        Ta       a  | Ta        Cg        gt Ta        Ta        at At        Ta        cg Gc        Ta        at                         ctttttattctaacaacacttctgcactacccatctgatctcttttagacaagctatacagatagataaactctcttggtgcattaaatagtagatgtctgcttaagcaaaattttctatatacttaagaaatgaagaaagagggcatatgacgatcaaaatgatctttcatatcctatcttataactactgatttaatgtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG2208 Serine phosphatase RsbU, regulator of sigma subunit ... can be seen here     ..................................................................................................................