Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.70 kcal/mol
Antiterminator:    Distance from promoter:46 nt. Size=67 nt.     Delta G= -5.43 kcal/mol
Anti-antiterminator:    Distance from promoter:31 nt.    Size=19 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATG-TATCAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATGTTGTTAAGGAAGGCGATATCATTGATGTAAAACTCTTAAGCATCAATGAAAA
AGGTCAACTTAAGTTGAGCCATAAAGCAACTCTAGAATAAtctttcacatacattctattctatacgctt
aacatgaaaagctagtcttcttagaaagactagctttttttATG

    CP0856


Gene: CP0856     GI: 16752028     BI number: CP0856     GOG: -------     Description: hypothetical protei


            c
          a  a
          c  t
          t  a
          t  c
          t  a
          c  t
          t  t
          A  c
           At
           Ta
           At
           At
           Gc
           At
           Ta
          C  t
          T  a
          C  c
          A  |
          A  |
           Cg
           Gc
           At        ta
           At       t  g
          |  a      c  a
          |  a       ta
          A  c       ta
 TA        Ta        cg
T  A       At        ta
 CG        Cg        gc
 AT       |  a       at
 AT       |  a       ta
 CG       |  a       cg
 TA       |  a       gc
|  G       Cg        at
 GC        Gc        at
 GC        At        at
                        ttttATG


    ..................................................................................................................