                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCGGCCTTACCGCTTGGCTATGCCACCaaaggggaggatgagaatccttagtttaagcgaaagaagattttatggta
agcgagaagtgcgcataattctagagactagggaaatcttagtcgtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatca
acctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccat
agatgctgtaggcaaaattatATG

    CP0967 --- CP0966 --- CP0965 --- CP0964 --- CP0963 --- CP0962 --- CP0961 Gene: CP0967     GI: 16752137     BI number: CP0967     GOG: COG0770     Description: UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase Gene: CP0966     GI: 16752136     BI number: CP0966     GOG: COG0472     Description: phospho-N-acetylmuramoyl-pentapeptide- transferase Gene: CP0965     GI: 16752135     BI number: CP0965     GOG: COG0771     Description: UDP-N-acetylmuramoylalanine--D-glutamate ligase Gene: CP0964     GI: 16752134     BI number: CP0964     GOG: COG1388     Description: conserved hypothetical protein Gene: CP0963     GI: 16752133     BI number: CP0963     GOG: COG0772     Description: cell division protein FtsW Gene: CP0962     GI: 16752132     BI number: CP0962     GOG: COG0707     Description: UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase Gene: CP0961     GI: 16752131     BI number: CP0961     GOG: COG0773,COG1181     Description: UDP-N-acetylmuramate--alanine ligase/D-alanine--D-alanine ligas ag g  a ta at gc gc at gt |  a |  g |  t |  t |  t |  a |  a |  g |  c |  g |  a |  a |  a |  g |  a g  a g  g g  a       gc at       c  a at       g  t at       t  a C  t      g  a C  a       at At        at Cg        gc Cg        at Gt       g  a Ta       c  g A  |      g  a Ta       a  g Cg       a  |        a Gc        ta       a  a |  g       gc       g  t |  a       gt        gc G  g       ta        gt Ta       a  g       at Ta       t  g       ta Cg        tg        cg Gt        ta        at Cg        ta        gc                         gtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatcaacctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccatagatgctgtaggcaaaattatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0770 UDP-N-acetylmuramyl pentapeptide synthase ... can be seen here [M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here [M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here [M] COG1388 FOG: LysM repeat ... can be seen here [D] COG0772 Bacterial cell division membrane protein ... can be seen here [M] COG0707 UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase ... can be seen here [M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................