                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.91 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCTCGCTAAAGGAGATAAAGTCACTGCCATGGGAATCATCGGCACTGTTGACGAT
ATCCGTGAGCACACGGTAATTTTAAATATTGCTTCTGGAAAAGTAGAAGTTTTAAAAG
GAGCTATTTCTGAAATCCTCAAGCCTAACGATAACAAATCATAAggaatttcttttgagactttcat
cccacgattaaaatcgtgggatttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagt
ctgggatttttatcgttATG

    CP0983 Gene: CP0983     GI: 16752153     BI number: CP0983     GOG: COG2871     Description: NADH:ubiquinone oxidoreductase, beta subunit, putativ             C           A  A           A  A            TA            AT            GC           C  A           A  T           A  A            TA            Cg            Cg           |  a           |  a           |  t           |  t           |  t           |  c           |  t            Gt            At AA        At        aa A  A       Cg       t  a TG        Ta        ta TG        Cg        at TA       C  a       gc TG       T  c       cg GC        At        at AT        At        cg |  A       At        cg |  T       Gc        cg |  T       Ta        ta AT       C  |       at GC       T  |      c  t AT       T  |      t  | TG       T  |      t  | G  A      A  |      t  | A  A      T  |      c  | A  A      C  |       at A  |      G  |       gc AT        At        at GC        Gc        gt GC        Gc        ta                         tttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagtctgggatttttatcgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2871 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_AR39                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.40 kcal/mol Antiterminator: Size=70 nt.     Delta G= -8.91 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G= -8.41 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGATCTCGCTAAAGGAGATAAAGTCACTGCCATGGGAATCATCGGCACTGTTGACGAT ATCCGTGAGCACACGGTAATTTTAAATATTGCTTCTGGAAAAGTAGAAGTTTTAAAAG GAGCTATTTCTGAAATCCTCAAGCCTAACGATAACAAATCATAAggaatttcttttgagactttcat cccacgattaaaatcgtgggatttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagt ctgggatttttatcgttATG     CP0983 Gene: CP0983     GI: 16752153     BI number: CP0983     GOG: COG2871     Description: NADH:ubiquinone oxidoreductase, beta subunit, putativ             c           t  a           t  t            tc            cc            ac           g  a           a  c           g  g            ta            tt   C        tt A  A      |  a A  A      |  a TA       |  a AT       | GC       | C  A      | A  T      | A  A       t TA        c Cg        t Cg        t |  a       t |  a       a |  t      a |  t      g |  t       g |  c       A |  t       A Gt        T At        A At       C  |       aa Cg       T  |      t  a Ta       A  |       ta Cg       A  |       at C  a      A  |       gc T  c      C  |       cg At       A  |       at At       A  |       cg At        T        cg Gc        A        cg Ta        G        ta                         tttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagtctgggatttttatcgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2871 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF ... can be seen here     ..................................................................................................................