                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGCTTGTTTATAACGAATACGTTCTTGTCAATTATGAAATCACGACCTCTTAGgtcg
ctaaaatgccattaatgcaagtatacttctgggtattaaaaaagaaaacaatatttaccgagggaacgtttgctttttctgggatatataggcgaggttc
aatacagaatcagcgaagaaaaaagcaatgctgaaaattaatctttaggtctaaaataagcacagggtcctcttcttaatgagatgcatgcatttatgaa
ggggggttctttttgaaatcttgattacagtgagtgagaatATG

    CP1037 --- CP1038 Gene: CP1037     GI: 16752206     BI number: CP1037     GOG: COG1249     Description: 2-oxo acid dehydrogenase, E3 component, lipoamide dehydrogenase, putative Gene: CP1038     GI: 16752207     BI number: CP1038     GOG: COG0320     Description: lipoic acid synthetas gt        at g  c      c  g gc        gc at        ta c  c       at a  t       gt c  t       at gc       g  a at       t  t at       a  g ta       a  | a  a       ta a  t       ta a  g       cg a  |       tg ta        tg cg        cg ta        tg gt        cg             ttctttttgaaatcttgattacagtgagtgagaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1249 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes ... can be seen here [H] COG0320 Lipoate synthase ... can be seen here     ..................................................................................................................