Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGAGTCCCGGTGATTGAAGACGGTTTCCGATAGCCACTAGGATCACTGAGGTTCC
TTCCTCTCTGAGATAAAAACTCATatttttcgtgtaaagactaacaaatcagttttataggaatgcaaagattgtataaaga
tcgagcatcttggtcgctctactctacagtgaagcacgtgttttatcttgactgttagaaaagaaaatatttccagaattgactcttttacacgtagttg
aacttagttctaggggatctaggttttatttatatttaataaaacaaaaggaaaaataatGTG

    CP1039


Gene: CP1039     GI: 16752208     BI number: CP1039     GOG: -------     Description: hypothetical protei


 aa
a  a
g  t
a  a
 at
 at
 at
 gc
a  |
t  |
t  |       ac
 gc       c  g
 ta        at
 cg        ta
a  a       tg
g  a      t  t
t  t      t  t
t  t       cg
 cg        ta
 ta       |  a        g
|  c      c  c      a  g
|  t       at       t  g
|  c       gt        cg
a  t       ta        ta
t  t       tg       t  t
t  t       at        gc
t  t       at        at
 ta        gc        ta
 gc        at        tg
 ta       |  a       cg
 gc        cg        at
 cg        cg        at
                        ttatttatatttaataaaacaaaaggaaaaataatGTG


    ..................................................................................................................