Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:157 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTATTTCCTTTTATTGGAACAAGAAATATCCCTATCAAAGCAATCAATTTTTTCATt
gcatgcgcctcccaaagttaattatgtcacgatgagactttcaaatctggagcagtaaaaatacgctgttttagtatttcttatttaattaaaaataacc
aagaaaaacactctactaatgcatctttactctcgcaacctgaaacgattccctccttgttttttcatccttgatatggtaaagtaggcttttcttcgca
tttcatctcagtgaaaaagattttacacatggaaattgaaagATG

    CP0082 --- CP0081


Gene: CP0082     GI: 16752375     BI number: CP0082     GOG: COG2271     Description: GlpT/PgpT/UhpT family protein
Gene: CP0081     GI: 16752374     BI number: CP0081     GOG: COG0587     Description: DNA polymerase III, alpha subuni



 ca
t  c
g  g
 ta
 at
 tg
 ta
a  |
a  |
 tg
 ta
 gc
 at
 at
 at        aa
|  c      a  t
|  a      a  a
|  a      a  c
c  a       tg
c  t       gc
c  c       at
t  t       cg
 cg        gt
 cg        at
g  a       gt
 cg        gt
 gc        ta
 ta        cg
a  |      |  t
 cg        ta
 gt        at
 ta        at
 Ta        at
            cttatttaattaaaaataaccaagaaaaacactctactaatgcatctttactctcgcaacctgaaacgattccctccttgttttttcatccttgatatggtaaagtaggcttttcttcgcatttcatctcagtgaaaaagattttacacatggaaattgaaagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG2271 Sugar phosphate permease ... can be seen here
[L] COG0587 DNA polymerase III, alpha subunit ... can be seen here

    ..................................................................................................................