Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:107 nt.     Distance to run of Ts=1 nt.   Size=14 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=35 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=42 nt.     Delta G= -5.54 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCT-TACAAT. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCTAAGCCACGATTTTGTGATACAATAAATATCTACATTACCATGCAAACAAACA
TGGAAAGAGAAATTATTATAGAGAAGCGCTAGTCTTTATTCTCCATAGTATCCTTGCA
TACTGATAGGCATAAAGAAGAGTGAGCCGCGATGTAATAATAGTATAGGTTCCCTGGA
ACCCTTTTCTGTTCGCAAGGCATtctctgcacagatgcaaaatataaagttaaacacagaaatccttctacagtcagaaggat
atcaaacaaagatagaggaagtagaaggaaattATG

    CP0092


Gene: CP0092     GI: 16752385     BI number: CP0092     GOG: COG0847     Description: DNA polymerase III, epsilon subunit, putativ


 AA
G  G
A  A
A  G
A  T
T  G       AT
A  A      A  A
 CG        TA
 GC        GT
 GC        TA
A  G      |  G
T  |      A  T
A  |      G  A
 GC       C  T
 TG       G  A
C  |       CG
A  |       CG        CT
 TA        GT       C  G
 AT        AT        CG
 CG        GC        TA
 GT       T  C       TA
 TA        GC        GC
 TA        AT        GC
                        CTTTTCTGTTCGCAAGGCATtctctgcacagatgcaaaatataaagttaaacacagaaatccttctacagtcagaaggatatcaaacaaagatagaggaagtagaaggaaattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0847 DNA polymerase III, epsilon subunit and related 3'-5' exonucleases ... can be seen here

    ..................................................................................................................