                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:134 nt.    Distance to gene:107 nt.     Distance to run of Ts=1 nt.   Size=14 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=35 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=42 nt.     Delta G= -5.54 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCT-TACAAT. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCTAAGCCACGATTTTGTGATACAATAAATATCTACATTACCATGCAAACAAACA
TGGAAAGAGAAATTATTATAGAGAAGCGCTAGTCTTTATTCTCCATAGTATCCTTGCA
TACTGATAGGCATAAAGAAGAGTGAGCCGCGATGTAATAATAGTATAGGTTCCCTGGA
ACCCTTTTCTGTTCGCAAGGCATtctctgcacagatgcaaaatataaagttaaacacagaaatccttctacagtcagaaggat
atcaaacaaagatagaggaagtagaaggaaattATG

    CP0092 Gene: CP0092     GI: 16752385     BI number: CP0092     GOG: COG0847     Description: DNA polymerase III, epsilon subunit, putativ AA G  G A  A A  G A  T T  G       AT A  A      A  A CG        TA GC        GT GC        TA A  G      |  G T  |      A  T A  |      G  A GC       C  T TG       G  A C  |       CG A  |       CG        CT TA        GT       C  G AT        AT        CG CG        GC        TA GT       T  C       TA TA        GC        GC TA        AT        GC                         CTTTTCTGTTCGCAAGGCATtctctgcacagatgcaaaatataaagttaaacacagaaatccttctacagtcagaaggatatcaaacaaagatagaggaagtagaaggaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0847 DNA polymerase III, epsilon subunit and related 3'-5' exonucleases ... can be seen here     ..................................................................................................................