                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGAATCTTCAGATAGCGACACTCAAACTGAAAAAGATGAAGAAGGCGGTTCTGAAG
AGAATACTGCTGAATAGtttttagtttttaaaagacaaacaagagggtgaaagccctctatttgtctttttcccccatgagttgacaa
gttatttccatactcacaactctcttatattaaaattttggagattgtttttgttctatgtagcgacaaataatttctaaaagagtctttgctccttatc
cctctcttctgaaatttcttgacccattcatagtccaaagcataacatggttacATG

    CP0148 --- CP0149 --- CP0150 --- CP0151 Gene: CP0148     GI: 16752440     BI number: CP0148     GOG: -------     Description: hypothetical protein Gene: CP0149     GI: 16752441     BI number: CP0149     GOG: COG0747     Description: peptide ABC transporter, periplasmic peptide-binding protein, putative Gene: CP0150     GI: 16752442     BI number: CP0150     GOG: COG0601     Description: peptide ABC transporter, permease protein, putative Gene: CP0151     GI: 16752443     BI number: CP0151     GOG: COG1173     Description: peptide ABC transporter, permease protein, putativ AA G  G TA CG TA |  A |  T TA GC GT        tt CG       t  t GC       g  t GT       a  a A  G       ta A  A       ta G  |       ta        aa A  |       tg       g  a A  |       ta        tg G  |       Gc        gc TA       A  a       gc AT       T  a       gc G  A      A  a       at A  G      A  c       gc At       G  a       at At        Ta       a  a At        Cg       c  | At       |  a       at Gt       G  g       at Ta        Tg        at Cg        Cg        cg At        At        at At        Tg        gc                         tttttcccccatgagttgacaagttatttccatactcacaactctcttatattaaaattttggagattgtttttgttctatgtagcgacaaataatttctaaaagagtctttgctccttatccctctcttctgaaatttcttgacccattcatagtccaaagcataacatggttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................