                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgttgtttcatgtcaaaatgaacgtagtcagatacagaatcgtgagagctgtatgaaaatgctacaagcaaagttgtatcagcaggttttacaagaacgt
ttagagaagcaatctcttgatcgcaaagataaaaaggaaattgcttggggatctcaaattcgcaactacgtatttcagccctatactcttgttaaagatg
tacgtacgggacatgaaacaggaaatgtccaagcgatgctcgacggcgagctattggatgaatttattaaagcatatttggcagagtttggagaagtttc
ATG

    CP0174 --- CP0175 --- CP0176 Gene: CP0174     GI: 16752463     BI number: CP0174     GOG: COG0454     Description: acetyltransferase, GNAT family Gene: CP0175     GI: 16752464     BI number: CP0175     GOG: NOG41238     Description: hypothetical protein Gene: CP0176     GI: 16752465     BI number: CP0176     GOG: COG0217     Description: conserved hypothetical protei tt g  a ta        ca ta       a  g cg       a  g ta       a  a |  t      g  a cg        ta at        at        cg |  a       cg       a  g |  c       at        gc tg        gc        cg at        gc        ta ta       g  a       cg |  c      c  a       gc cg       a  |      t  t cg        tg       a  a cg        gc       g  | |  a       cg       c  | |  c      |  a      g  | g  a       at        at at        tg        at cg        gc        cg ta       t  |       cg ta        at        ta ta        gc        gt                         gaatttattaaagcatatttggcagagtttggagaagtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [S] COG0217 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................