                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACAGGCTTGAGTTTAGAGATTTTGGTGTGTTGCAAGTAGTAGAAAGAAAACCAAA
GGTAGGACGTAATCCTAAGAATGCAGCAGTCCCCATTCATATTCCTGCTAGACGCGCT
GTAAAGTTTACTCCAGGGAAAAGAATGAAGCGCTTGATAGAAACTCCGAATAAGCATT
CTTAAttcttgtagtcttctttgtctcagttgttagagtcagaccggttttttaccgggcttgactctaatttttgttattattatcgtttggtgca
atgcttttctgatcaaattgtgcgtgataATG

    CP0339 Gene: CP0339     GI: 16752624     BI number: CP0339     GOG: NOG04842     Description: conserved hypothetical protei             t           t  t           t  t            ta tg        gc t  t       gc g  t       cg a  a       cg cg       |  g ta       a  c cg        gt t  t       at gc        cg ta        ta tg        gc ta        at c  c       gc t  c       at tg        ta cg        ta             tttttgttattattatcgtttggtgcaatgcttttctgatcaaattgtgcgtgataATG     ..................................................................................................................