Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=48 nt.     Delta G=-11.02 kcal/mol
Anti-antiterminator:    Distance from promoter:5 nt.    Size=51 nt.     Delta G=-11.87 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATC-TATTAT. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATCTTAGCTGTGAGCTTAGTTATTATAGGTTCTCTTTTTCTTCTTGCTGGGGTTG
CCATACTCACAGTATTTTCTCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGAT
TGTTCTGGGACTTCTTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAA
TCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG


    CP0555


Gene: CP0555     GI: 16752830     BI number: CP0555     GOG: -------     Description: hypothetical protei


 CC
G  A        A
T  T      T  G
 TA       T  T
 GC       A  T
 GT       C  T
 GC       T  T
|  A      T  T
 GC        TG
 TA        CG
 CG        CG
 GT       T  G       TG
 TA       G  T      T  T
T  T       AT        AT
C  T       GC        GC
T  T       GT        GT
T  T      T  |      G  |
C  C       AT       T  |
T  T       CG        TG
T  C       TG        CG
T  A       CG        TG
T  T       TA        TA
 TG       T  T       GC
 CG       T  T       GT
 TA        TG        GT
 CG        AT        GC
                        TTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGATACAACAGAAGAGGTGCTTTAAACAAAGTACTTTTGTGATCTTAGCTGTGAGCT
TAGTTATTATAGGTTCTCTTTTTCTTCTTGCTGGGGTTGCCATACTCACAGTATTTTC
TCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGATTGTTCTGGGACTTCTTTTA
TTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaact
ttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG

    CP0555


Gene: CP0555     GI: 16752830     BI number: CP0555     GOG: -------     Description: hypothetical protei


            C
          T  T
          C  T
          T  T
          T  T
           GT
           GC
           AT
          T  T
          A  C
          T  T
          T  T
          A  |       CC
          T  |      G  A
  A        TG       T  T
T  T       GC        TA
T  T       AT        GC
G  A       TG        GT
 AT        TG        GC
 TA        CG       |  A
 TG       G  G       GC
 CG        AT        TA
 GT        GT        CG
 AT        TG        GT
 GC        GC        TA
                        TTTTCTCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGATTGTTCTGGGACTTCTTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG


    ..................................................................................................................