                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:21 nt.    Distance to gene:108 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=24 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTC-AAGAAT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTCAAGGAAATTCTTTTTTTAAAGAATTCTAAataatttaagaatcttccttagggctcttgaagctcgga
ggcttttctaattaaatttacaatggtctaagaattatttttatataaatatttctttataaaaagatgatttttaaatttattaagctgttgttgaatt
aatagcttcttaataaGTG

    CP0587 --- CP0588 --- CP0589 --- CP0590 Gene: CP0587     GI: 16752860     BI number: CP0587     GOG: -------     Description: hypothetical protein Gene: CP0588     GI: 16752861     BI number: CP0588     GOG: -------     Description: hypothetical protein Gene: CP0589     GI: 16752862     BI number: CP0589     GOG: -------     Description: hypothetical protein Gene: CP0590     GI: 16752863     BI number: CP0590     GOG: -------     Description: hypothetical protei AT A  T GC AT |  A |  A A  a At Ta Ta T  t T  t T  t                  t Ta        ct       t  g Ta       c  t      c  a Cg       t  a       ta Ta        tg        cg Ta        cg        gc At       t  g       gt |  c      a  c       gc At        at       a  g At        gc        tg Gc        at        ta Gc        at        cg At        tg        cg                         cttttctaattaaatttacaatggtctaagaattatttttatataaatatttctttataaaaagatgatttttaaatttattaagctgttgttgaattaatagcttcttaataaGTG     ..................................................................................................................