                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.69 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACAACGGTGAGCCTAATGAAAGAAATTCAGCAACTCCTCCTCTAGAGGGTGGTGTTG
CAGGAGAAGCCGGTCGCGGCGGGGGGTCACCTTTAACCCAACTTGATCTCAATTCAGG
GGCGGGAAGTTAGattttttatctaacctactaagttagtattttaactgtaggtttttccttccgttgttttaaaagaacctcaagaata
actagaggttcttgtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG

    CP0625 --- CP0624 Gene: CP0625     GI: 16752896     BI number: CP0625     GOG: COG1262     Description: conserved hypothetical protein Gene: CP0624     GI: 16752895     BI number: CP0624     GOG: COG0272     Description: DNA ligas            tt           g  g           c  t at       c  t t  t      t  t        t gt       t  t      a  a at       c  a      a  a ta       c  a       gc ta        ta        at gc        ta       a  a at        tg        cg a  |       ta        ta t  |       ta        cg cg        gc        cg at        gc        at ta        at        at cg       t  |       gc cg        gc        at at        ta        at                         gtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1262 Uncharacterized conserved protein ... can be seen here [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_AR39                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.80 kcal/mol Antiterminator: Size=37 nt.     Delta G= -4.69 kcal/mol Anti-antiterminator:   Size=32 nt.     Delta G=-10.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AACAACGGTGAGCCTAATGAAAGAAATTCAGCAACTCCTCCTCTAGAGGGTGGTGTTG CAGGAGAAGCCGGTCGCGGCGGGGGGTCACCTTTAACCCAACTTGATCTCAATTCAGG GGCGGGAAGTTAGattttttatctaacctactaagttagtattttaactgtaggtttttccttccgttgttttaaaagaacctcaagaata actagaggttcttgtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG     CP0625 --- CP0624 Gene: CP0625     GI: 16752896     BI number: CP0625     GOG: COG1262     Description: conserved hypothetical protein Gene: CP0624     GI: 16752895     BI number: CP0624     GOG: COG0272     Description: DNA ligas            cc           t  t at       t  t t  t      t  c gt       t  c at       t  g ta       g  t        t ta       g  t      a  a gc        ag       a  a at        tt        gc a  |       gt        at t  |       tt       a  a cg        ct        cg at        aa        ta ta        aa        cg cg        ta        cg cg       t  |       at at        ta        at at        tg        gc                         ttgtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1262 Uncharacterized conserved protein ... can be seen here [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_AR39                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol Antiterminator: Size=29 nt.     Delta G= -5.90 kcal/mol Anti-antiterminator:   Size=28 nt.     Delta G= -7.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AACAACGGTGAGCCTAATGAAAGAAATTCAGCAACTCCTCCTCTAGAGGGTGGTGTTG CAGGAGAAGCCGGTCGCGGCGGGGGGTCACCTTTAACCCAACTTGATCTCAATTCAGG GGCGGGAAGTTAGattttttatctaacctactaagttagtattttaactgtaggtttttccttccgttgttttaaaagaacctcaagaata actagaggttcttgtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG     CP0625 --- CP0624 Gene: CP0625     GI: 16752896     BI number: CP0625     GOG: COG1262     Description: conserved hypothetical protein Gene: CP0624     GI: 16752895     BI number: CP0624     GOG: COG0272     Description: DNA ligas   C         t        at T  A      t  t      t  t C  A      t  t       gt T  T       ta        at AT        at        ta GC        Gc        ta TA        At        gc TG        Ta        at CG        Ta       a  | |  G       Gc       t  | A  G      A  c       cg A  C      A  t       at CG       G  a       ta CG        Gc        cg CG        Gt        cg                         tttttccttccgttgttttaaaagaacctcaagaataactagaggttcttgtttgtttattgcaatcttcgtttttgctatctatagttaacttatataaatataaggcaaatggtggagagttagctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1262 Uncharacterized conserved protein ... can be seen here [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................