                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:18 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:146 nt. Size=40 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=45 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtct-taattt. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtctactaagaattccattcttaatttttgttcgcacttcgagatttctagagtatcccatgacaatgcaatacaaaagatccgttcctacccactaa
aacctatagcagaaaataggatcaatacgctttcatttaaagatctgaaaatcgattaccctaaagactcgtccaaaaggtttcgatttttgtatagtat
tggaagaatccctttgcataagctgtgggaatattttgtaacatagtagtagcgctGTG

    CP0631 --- CP0632 --- CP0633 Gene: CP0631     GI: 16752902     BI number: CP0631     GOG: COG0120     Description: ribose 5-phosphate isomerase Gene: CP0632     GI: 16752903     BI number: CP0632     GOG: COG1259     Description: conserved hypothetical protein Gene: CP0633     GI: 16752904     BI number: CP0633     GOG: COG1678     Description: transcriptional regulator, putativ tc c  g       gt at       a  a gc       t  t a  c       at a  a       tg a  a      g  g t  a       ta c  a       ta cg        tg cg        ta at        ta t  t       at        ta t  |       gc       a  a at       c  |       cg gc       t  |       gc cg       t  |      t  t ta       t  |      t  g at        gc       t  t at        gc        cg at        at        cg at        at        cg gt        at        ta                         atattttgtaacatagtagtagcgctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0120 Ribose 5-phosphate isomerase ... can be seen here [S] COG1259 Uncharacterized conserved protein ... can be seen here [K] COG1678 Putative transcriptional regulator ... can be seen here     ..................................................................................................................