Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions

AAGAAGACGCACTACCTGCTGCTAAAGGAAAGAAAAAAGTTGTAACTAAGAAAAAGAA
ATAAaacttcttttagatttcccatttataaaacccattctcaggctctcaagcccgagaatgggtttttttgtgagggctttctctcttgcaatag
cttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaatttttta
tctgattccatttgatactgatttttcaccactttttagggattcATG

    CP0660 --- CP0659 --- CP0658 --- CP0657 --- CP0656 --- CP0655 --- CP0654 --- CP0653 --- CP0652 --- CP0651


Gene: CP0660     GI: 16752931     BI number: CP0660     GOG: COG0216     Description: peptide chain release factor 1
Gene: CP0659     GI: 16752930     BI number: CP0659     GOG: COG2890     Description: modification methylase, HemK family
Gene: CP0658     GI: 16752929     BI number: CP0658     GOG: COG0541     Description: signal recognition particle protein FFH
Gene: CP0657     GI: 16752928     BI number: CP0657     GOG: COG0228     Description: ribosomal protein S16
Gene: CP0656     GI: 16752927     BI number: CP0656     GOG: COG0336     Description: tRNA (guanine-N1)-methyltransferase
Gene: CP0655     GI: 16752926     BI number: CP0655     GOG: COG0335     Description: ribosomal protein L19
Gene: CP0654     GI: 16752925     BI number: CP0654     GOG: COG0164     Description: ribonuclease HII
Gene: CP0653     GI: 16752924     BI number: CP0653     GOG: COG0194     Description: guanylate kinase
Gene: CP0652     GI: 16752923     BI number: CP0652     GOG: NOG08324     Description: conserved hypothetical protein
Gene: CP0651     GI: 16752922     BI number: CP0651     GOG: COG0143     Description: methionyl-tRNA synthetas


          tc
         c  a
          ta
          cg
          gc
          gc
         a  c
          cg
          ta
          cg
          ta
          ta
          at
          cg
          cg
          cg
          at
          at
          at
            ttttgtgagggctttctctcttgcaatagcttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaattttttatctgattccatttgatactgatttttcaccactttttagggattcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0216 Protein chain release factor A ... can be seen here
[J] COG2890 Methylase of polypeptide chain release factors ... can be seen here
[U] COG0541 Signal recognition particle GTPase ... can be seen here
[J] COG0228 Ribosomal protein S16 ... can be seen here
[J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here
[J] COG0335 Ribosomal protein L19 ... can be seen here
[L] COG0164 Ribonuclease HII ... can be seen here
[F] COG0194 Guanylate kinase ... can be seen here
[J] COG0143 Methionyl-tRNA synthetase ... can be seen here

    ..................................................................................................................