Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.90 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=35 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=45 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-cATGCT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatatcttcaagataaatcccATGCTCTCCTCTAACTCTCTAAGAAAAAATTCCTATAAACATAG
AATTCAAAAAAGAAGAATTGCCTTTCTATGTTTGTTTGAAAGTAGGCCTTCTTCTAGA
TCCAAAGATTCCCTATTGGGAATATTTTTCTGAaaacgatacaatcttgtataaggtagagagctatgctatgtgc
tttgaatctatcttaatgtacaactaactacataattttctATG

    CP0690


Gene: CP0690     GI: 16752960     BI number: CP0690     GOG: NOG05811     Description: conserved hypothetical protei


  T
T  T
G  G
T  T
A  T
T  T
 CG
 TA         A
 TA       G  T
|  A      A  C
|  G      T  C
|  T      C  A
 TA        TA
 CG        TA
 CG        CG
 GC        TA
T  C      T  T
T  |      C  T       AT
 AT       C  C      T  T
 AT        GC        CG
 GC        GC        CG
 AT        AT        CG
 AT        TA        TA
 GC        GT        TA
 AT        AT        AT
                        ATTTTTCTGAaaacgatacaatcttgtataaggtagagagctatgctatgtgctttgaatctatcttaatgtacaactaactacataattttctATG


    ..................................................................................................................