Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-16.04 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAGGCCCCAGAGGAGAAACCGAGTTTGCTGGATAAAGCGCGTTCTTTATTTACTCGC
GAGGACCATTCCTAGcataactccaagagttgtgtttctttaaaaattctttgaataaaatactatatgttagtagcttagtgggttta
acttatgtgtttgagcatgatggcgccacagattcataatgcaagtacctctatcaccacagctacccccccccccccccagaccactctgtaggggctt
ttttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG

    CP0795 --- CP0794


Gene: CP0795     GI: 16753061     BI number: CP0795     GOG: -------     Description: hypothetical protein
Gene: CP0794     GI: 16753060     BI number: CP0794     GOG: -------     Description: hypothetical protei


            A
          T  T
          T  T
          T  T
          C  A
          T  C
          T  T
           GC
           CG
           GC
           CG
          |  A
          |  G
          |  G
          G  A
          A  C
          A  C
          A  A
          T  T
           AT
 AT        GC
G  A       GC
G  A      |  T        a
 TA        TA       c  a
 CG        CG        cg
 GC        Gc        ta
 TG        Ta        cg
T  C      |  t       at
T  G       Ta        at
 GT        Ta        tg
 AT        Gc        at
 GC        At        cg
 GT        Gc        Gt
                        ttctttaaaaattctttgaataaaatactatatgttagtagcttagtgggtttaacttatgtgtttgagcatgatggcgccacagattcataatgcaagtacctctatcaccacagctacccccccccccccccagaccactctgtaggggcttttttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG


    ..................................................................................................................