                                                                        Gene putatively regulated by attenuation in C_pneumoniae_AR39

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatagtcatcctcccagaggatgctaggttgttgttttgttgaggggatcagagatagggaaacacggtcgccaggttgtaccttgtaggattcaaatct
ttctatgaacccgttcactcgacatcgatgttggcgaatagacgccaagatttcttgcttgctatgattaggcagttgagatctaagaaaagaagataat
cttgagacttgtgtggcaagccaggaaaaattttccataaaatattgtaaagcagcccttttatcatttgataattgcataaaattttaagagattttgt
ATG

    CP0353 --- CP0354 Gene: CP0353     GI: 16753072     BI number: CP0353     GOG: COG1194     Description: A/G-specific adenine glycosylase Gene: CP0354     GI: 16752637     BI number: CP0354     GOG: COG1694     Description: mazG protein, putativ   a a  a c  t t  c t  t at gt gc at ta gt tg ta |  a |  c |  c c  c cg at t  t       ca gc       a  t ta        gc t  |       cg gc        ta        ta gt       |  t      a  g a  |       cg       a  a c  |       at        gc c  |      c  t       cg gc       t  g       gc cg        tg        gc ta        gc        ta gc        cg        ta                         gatttcttgcttgctatgattaggcagttgagatctaagaaaagaagataatcttgagacttgtgtggcaagccaggaaaaattttccataaaatattgtaaagcagcccttttatcatttgataattgcataaaattttaagagattttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1194 A/G-specific DNA glycosylase ... can be seen here [R] COG1694 Predicted pyrophosphatase ... can be seen here     ..................................................................................................................