                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-14.90 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.82 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAGTCTTAACAGATGCAGCTTGTTGTAGCAAAACCGACTACCTTCTTGGATTTAAG
GAAAATGTGATCATGGGTCATATGATTCCTGGTGGTACAGGCTTTGAAACGCATAAGC
GTATTAAGCAGTATCTAGAAAAAGAACAAGAAGATCTCGTTTTTGATTTTGTTAGTGA
AACAGAGTGTGTTTGTTAActaggtgacacagtcttttatcaaggaggttatgtttacaacctccttgataggaatgttttttttg
ttaacgttgcctagagatcaacagtgatgccaaggtgcctATG

    tal Gene: tal     GI: 15618007     BI number: CPn0083     GOG: COG0176     Description: Transaldolas            Ac           A  t           T  a           T  g           G  g           T  t            Tg   T        Ta T  G       Gc T  T       Ta T  T       Gc A  A       Ta G  G      G  g T  T       At TG        Gc TA        At        tt TA       C  |      g  t TA       A  |      t  a GC        At       a  c |  A       At        ta CG        Gt        ta TA        Ta        gc CG        Gt        gc T  T      A  c       at A  G       Ta        gc G  T       Ta        gc A  G      G  g       at A  |       Tg        at GT        Ta        cg AT        Tg        ta AT        Tg        at CG        At        ta AT        Gt        tg AT        Ta        tg                         aatgttttttttgttaacgttgcctagagatcaacagtgatgccaaggtgcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0176 Transaldolase ... can be seen here     ..................................................................................................................