Gene putatively regulated by attenuation in C_pneumoniae_CWL029
Characteristics of the secondary structures
Terminator: Distance from promoter:104 nt. Distance to gene:88 nt. Distance to run of Ts=0 nt. Size=16 nt. Delta G= -6.90 kcal/mol
Antiterminator: Distance from promoter:79 nt. Size=35 nt. Delta G= -5.40 kcal/mol
Anti-antiterminator: Distance from promoter:49 nt. Size=45 nt. Delta G=-10.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgata-catgct. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgatatcttcaagataaatcccatgctctcctctaactctctaagaaaaaattcctataaacatagaattcaaaaaagaagaattgcctttctatgttt
gtttgaaagtaggccttcttctagatccaaagattccctattgggaatatttttctgaaaacgatacaatcttgtataaggtagagagctatgctatgtg
ctttgaatctatcttaatgtacaactaactacataattttctATG

CPn0085
Gene: CPn0085 GI: 15618009 BI number: CPn0085 GOG: NOG05811 Description: CT311 hypothetical protei
t
t t
g g
t t
a t
t t
cg
ta a
ta g t
| a a c
| g t c
| t c a
ta ta
cg ta
cg cg
gc ta
t c t t
t | c t at
at c c t t
at gc cg
gc gc cg
at at cg
at ta ta
gc gt ta
at at at
atttttctgaaaacgatacaatcttgtataaggtagagagctatgctatgtgctttgaatctatcttaatgtacaactaactacataattttctATG
..................................................................................................................