Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions

AAGAAGACGCACTACCTGCTGCTAAAGGAAAGAAAAAAGTTGTAACTAAGAAAAAGAA
ATAAaacttcttttagatttcccatttataaaacccattctcaggctctcaagcccgagaatgggtttttttgtgagggctttctctcttgcaatag
cttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaatttttta
tctgattccatttgatactgatttttcaccactttttagggattcATG

    pfrA --- hemK --- ffh --- rs16 --- trmD --- rl19 --- rnhB_1 --- gmk --- CPn0121 --- metG


Gene: pfrA     GI: 15618037     BI number: CPn0113     GOG: COG0216     Description: Peptide Chain Releasing Factor
Gene: hemK     GI: 15618038     BI number: CPn0114     GOG: COG2890     Description: A/G specific methylase
Gene: ffh     GI: 15618039     BI number: CPn0115     GOG: COG0541     Description: Signal Recognition Particle GTPase
Gene: rs16     GI: 15618040     BI number: CPn0116     GOG: COG0228     Description: S16 Ribosomal Protein
Gene: trmD     GI: 15618041     BI number: CPn0117     GOG: COG0336     Description: tRNA (guanine N-1)-Methyltransferase
Gene: rl19     GI: 15618042     BI number: CPn0118     GOG: COG0335     Description: L19 Ribosomal Protein
Gene: rnhB_1     GI: 15618043     BI number: CPn0119     GOG: COG0164     Description: Ribonuclease HII
Gene: gmk     GI: 15618044     BI number: CPn0120     GOG: COG0194     Description: GMP Kinase
Gene: CPn0121     GI: 15618045     BI number: CPn0121     GOG: NOG08324     Description: CT031 hypothetical protein
Gene: metG     GI: 15618046     BI number: CPn0122     GOG: COG0143     Description: Methionyl-tRNA Synthetas


          tc
         c  a
          ta
          cg
          gc
          gc
         a  c
          cg
          ta
          cg
          ta
          ta
          at
          cg
          cg
          cg
          at
          at
          at
            ttttgtgagggctttctctcttgcaatagcttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaattttttatctgattccatttgatactgatttttcaccactttttagggattcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0216 Protein chain release factor A ... can be seen here
[J] COG2890 Methylase of polypeptide chain release factors ... can be seen here
[U] COG0541 Signal recognition particle GTPase ... can be seen here
[J] COG0228 Ribosomal protein S16 ... can be seen here
[J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here
[J] COG0335 Ribosomal protein L19 ... can be seen here
[L] COG0164 Ribonuclease HII ... can be seen here
[F] COG0194 Guanylate kinase ... can be seen here
[J] COG0143 Methionyl-tRNA synthetase ... can be seen here

    ..................................................................................................................