Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.10 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=32 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=43 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATC-AAGAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATCAAGTCTTTATGGTTTATAAGAATAAGAATCCTCAGGCCTTGGATAAAGAATA
CGAGGCGTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCT
TCTTCAGTGAAAAAGAAAGTGAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggca
atggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG

    CPn0233


Gene: CPn0233     GI: 15618157     BI number: CPn0233     GOG: -------     Description: hypothetical protei


  t
c  a
t  t
 ta
 at
 gt
 At         a
 At       t  a        g
T  |       tg       g  t
G  |       ta       g  t
 Tg        ta        cg
 Cg        gc        cg
 Ta       t  |       gc
 Gt        gc        ta
 At        ta        ta
 Gt       t  t       at
 Tg       t  t       cg
G  t      a  g       cg
A  g       gc        at
 At        gc        at
 At        tg        gt
 Gt        tg        at
 At        tg        at
                        ttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAGAGGGATGTTGATTTCCGTAAATCACACTCTTTATCAAGTCTTTATGGTTTATA
AGAATAAGAATCCTCAGGCCTTGGATAAAGAATACGAGGCGTTTTCTCAGTCTTTTAA
AATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTGAGT
CTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaa
agctctaattcttgagaaaaagcaaggactATG

    CPn0233


Gene: CPn0233     GI: 15618157     BI number: CPn0233     GOG: -------     Description: hypothetical protei


           GA
          A  A
           AT
           TA
          A  A
 GT        TG
T  C       TA
A  A       TA
 tA        GT
 cG        GC
 aT       T  C        A
 gC       A  T      A  G
 gT       T  C      A  A
 aT        TA       T  A
 aT        TG       A  T
|  A       CG       G  A
|  T      T  C       GC
|  G       GC        TG
 cG        AT        TA
 gT        AT        CG
 aT        CG        CG
 aT        TG        GC
                        GTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTGAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAGAGGGATGTTGATTTCCGTAAATCACACTCTTTATCAAGTCTTTATGGTTTATA
AGAATAAGAATCCTCAGGCCTTGGATAAAGAATACGAGGCGTTTTCTCAGTCTTTTAA
AATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTGAGT
CTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaa
agctctaattcttgagaaaaagcaaggactATG

    CPn0233


Gene: CPn0233     GI: 15618157     BI number: CPn0233     GOG: -------     Description: hypothetical protei


           TA
          A  A
           TG
 TA        TA
T  T      T  A
 GC        GT
 TA        GA
A  |       TA
 tA        AG
 cG        TA
 aT       T  A        A
 gC       T  T      A  G
 gT       C  C      A  A
 aT        TC       T  A
 aT        GT       A  T
|  A       AC       G  A
|  T      A  A       GC
|  G       CG        TG
 cG        TG        TA
 gT        AC        CG
 aT        TC        CG
 aT        TT        GC
                        GTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTGAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG


    ..................................................................................................................