Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAGTCATCCTCCCAGAGGATGCTAGGTTGTTGTTTTGTTGAGGGGATCAGAGATAG
GGAAACACGGTCGCCAGGTTGTACCTTGTAGGATTCAAATCTTTCTATGAACCCGTTC
ACTCGACATCGATGTTGGCGAATAGACGCCAAGATTTCTTGCTTGCTATGATTAGGCA
GTTGAGATCTAAGAAAAGAAGATAATCTTGAGACTTGTGTGGCAAGCCAGGAAAAATT
TTCCATAAAATATTGTAAAGCAGCCCTTTTATCATTTGATAATTGCATaaaattttaagagatt
ttgtATG

    mutY --- CPn0401


Gene: mutY     GI: 15618317     BI number: CPn0402     GOG: COG1194     Description: Adenine Glycosylase
Gene: CPn0401     GI: 15618316     BI number: CPn0401     GOG: COG1694     Description: CT255 hypothetical protei


  A
A  A
C  T
T  C
T  T
 AT
 GT
 GC
 AT
 TA
 GT
 TG
 TA
|  A
|  C
|  C
C  C
 CG
 AT
T  T       CA
 GC       A  T
 TA        GC
T  |       CG
 GC        TA        TA
 GT       |  T      A  G
A  |       CG       A  A
C  |       AT        GC
C  |      C  T       CG
 GC       T  G       GC
 CG        TG        GC
 TA        GC        TA
 GC        CG        TA
                        GATTTCTTGCTTGCTATGATTAGGCAGTTGAGATCTAAGAAAAGAAGATAATCTTGAGACTTGTGTGGCAAGCCAGGAAAAATTTTCCATAAAATATTGTAAAGCAGCCCTTTTATCATTTGATAATTGCATaaaattttaagagattttgtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG1194 A/G-specific DNA glycosylase ... can be seen here
[R] COG1694 Predicted pyrophosphatase ... can be seen here

    ..................................................................................................................