                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=25 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttctct-tataac. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttctctcccaagattgaaacttctataactgagagtcttctccagagcatttacttgatttatttaactgtattctctattggtgcaccatgctcctaaa
gccacatgctatgggagtatttttgataaaaagcttttccccaaagacacATG

    pmp_6 Gene: pmp_6     GI: 15618359     BI number: CPn0444     GOG: -------     Description: Polymorphic Outer Membrane Protein G/I Famil             c           a  a   c       c  t c  a       cg a  t       gc cg        at gc       a  a t  t       at gc        tg gc        cg t  t       cg t  a       ta a  a       cg ta        gt cg        ta             tttttgataaaaagcttttccccaaagacacATG     ..................................................................................................................