Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attcttattgaataagataattcactatttttagatcctaaattttaagtggtttttgttatgcttcttatagagaatagctgcaaagattagagttgca
gagacggtacgtctctttcttttttaagggaaggggtgttgttacacccatcctaagatttgtgagattcccctcaggcagtaacttttacaatcgtact
ttatgttttgatctagctgttttcttgtctttaatttattcaaccatcgagaagagagatccatgagtggaaatgtattttattaggatcatctctaagg
ATG

    yxjG_2


Gene: yxjG_2     GI: 15618363     BI number: CPn0448     GOG: COG0620     Description: Hypothetical Protei


            t
          t  a
          a  g
          g  a
          a  g
           at
           at
           cg
           gc
  t        ta
a  a       cg
 tg       g  |
 ta       a  |
 cg       t  |
 ta       a  |        t
|  a      a  |      g  a
|  t      g  |       gc
 ta       a  |       cg
 cg       g  |       at
 gc       a  |       gc
t  t      t  |       at
a  |      a  |       gc
t  |      t  |       at
 tg        ta       c  |
 gc        cg       g  |
 ta        ta       t  |
 ta       |  c      t  |
 ta        tg        gt
 tg        cg        at
 ta        gt        gc
 gt        ta        at
                        tttttaagggaaggggtgttgttacacccatcctaagatttgtgagattcccctcaggcagtaacttttacaatcgtactttatgttttgatctagctgttttcttgtctttaatttattcaaccatcgagaagagagatccatgagtggaaatgtattttattaggatcatctctaaggATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0620 Methionine synthase II (cobalamin-independent) ... can be seen here

    ..................................................................................................................