                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:157 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTATTTCCTTTTATTGGAACAAGAAATATCCCTATCAAAGCAATCAATTTTTTCATt
gcatgcgcctcccaaagttaattatgtcacgatgagactttcaaatctggagcagtaaaaatacgctgttttagtatttcttatttaattaaaaataacc
aagaaaaacactctactaatgcatctttactctcgcaacctgaaacgattccctccttgttttttcatccttgatatggtaaagtaggcttttcttcgca
tttcatctcagtgaaaaagattttacacatggaaattgaaagATG

    uhpC --- dnaE Gene: uhpC     GI: 15618575     BI number: CPn0665     GOG: COG2271     Description: Hexosphosphate Transport Gene: dnaE     GI: 15618576     BI number: CPn0666     GOG: COG0587     Description: DNA Polymerase III Alph ca t  c g  g ta at tg ta a  | a  | tg ta gc at at at        aa |  c      a  t |  a      a  a |  a      a  c c  a       tg c  t       gc c  c       at t  t       cg cg        gt cg        at g  a       gt cg        gt gc        ta ta        cg a  |      |  t cg        ta gt        at ta        at Ta        at             cttatttaattaaaaataaccaagaaaaacactctactaatgcatctttactctcgcaacctgaaacgattccctccttgttttttcatccttgatatggtaaagtaggcttttcttcgcatttcatctcagtgaaaaagattttacacatggaaattgaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2271 Sugar phosphate permease ... can be seen here [L] COG0587 DNA polymerase III, alpha subunit ... can be seen here     ..................................................................................................................