Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:94 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:87 nt. Size=34 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=37 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttatt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaattagaagacaaaaattttttatttccctagaatggctttgcatgtaagcgccttagtgtattccatgctgatggtgtgatctccaagggagtta
ggatttttagaaaattctttctcttttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgcta
tcttagctttgtcctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG

    CPn0692 --- abcX --- CPn0690 --- yfhO_1


Gene: CPn0692     GI: 15618602     BI number: CPn0692     GOG: COG0719     Description: ABC Transporter
Gene: abcX     GI: 15618601     BI number: CPn0691     GOG: COG0396     Description: ABC Transporter ATPase
Gene: CPn0690     GI: 15618600     BI number: CPn0690     GOG: COG0719     Description: ABC Transporter Membrane Protein
Gene: yfhO_1     GI: 15618599     BI number: CPn0689     GOG: COG0520     Description: NifS-related Aminotransferas


  a
t  g                  g
 ta        gg       a  g
 ta       t  g      t  t
 ta       c  c       gt
 ta       t  t       gc
 at       t  t      |  g
 gt        cg        gt
 gc        ta        gc
 at        ta        at
t  t       ta        at
t  t       tg        at
 gc        cg        gc
 at        tg        ta
 gc        cg        ta
 gt       t  t       cg
 gt        ta        gc
 at        tg        gc
 at        cg        gt
                        tctttgttatactgaaaaaataatctgtgtgctatcttagctttgtcctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here
[O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here
[O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here
[E] COG0520 Selenocysteine lyase ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=33 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:1 nt.    Size=50 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttatt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaattagaagacaaaaattttttatttccctagaatggctttgcatgtaagcgccttagtgtattccatgctgatggtgtgatctccaagggagtta
ggatttttagaaaattctttctcttttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgcta
tcttagctttgtcctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG

    CPn0692 --- abcX --- CPn0690 --- yfhO_1


Gene: CPn0692     GI: 15618602     BI number: CPn0692     GOG: COG0719     Description: ABC Transporter
Gene: abcX     GI: 15618601     BI number: CPn0691     GOG: COG0396     Description: ABC Transporter ATPase
Gene: CPn0690     GI: 15618600     BI number: CPn0690     GOG: COG0719     Description: ABC Transporter Membrane Protein
Gene: yfhO_1     GI: 15618599     BI number: CPn0689     GOG: COG0520     Description: NifS-related Aminotransferas


  g
c  c
 gc
 at
 at
 ta
g  |
 tg
 at
 cg
 gt        tg
 ta       g  t        a
t  t      g  g      t  g
t  t       ta        ta
c  |       at        ta
 gc        gc        ta
 gc       t  t       ta
 ta       c  c       at
 at        gc        gt
a  g       ta        gc
 gc       |  a       at
 at       a  g      t  t
 tg        cg       t  t
|  a       cg        gc
c  t       ta        at
 cg        tg        gc
 cg        at        gt
                        tttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgctatcttagctttgtcctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here
[O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here
[O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here
[E] COG0520 Selenocysteine lyase ... can be seen here

    ..................................................................................................................