                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-10.01 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTAATGGAGGGGACTTTCATAGACGGCAAACATGTGCGTCCTGTCTCTGTGACTAA
AATTCGTCGTGGTACAGTAAAGATCGTCGTGAGTGAAGGGAAAAAACACGAGATCCGG
TTGTTTGCAGATGCTGCAGGATTTCCTATTTTAGAGCTAAAGCGTATCCGTATAGGGA
GTTTGGTTTTAGGAGGCTTGCGTTATGGCGAATATCGCGAGCTTACAGATGCGGAACT
CGGGACCTACATGAAATTGTCTGACTAActtgtttttttatatactaacctgcaatagatagagccctATG

    CPn0865 Gene: CPn0865     GI: 15618774     BI number: CPn0865     GOG: NOG08100     Description: CT724 hypothetical protei   T G  A A  A C  A A  G TA GT GC TG        CA |  T      A  C GC       A  G CG       A  A        T T  |      A  G      A  G GT       A  A       GC CG        AT        AT TA        GC        CG TG        GC        GC AT       G  G       TA A  G      A  G      T  | A  A       AT       T  | A  |       GT       G  | T  |      T  G      T  | C  |      G  T      T  | A  |       AT       G  | G  |       GT       G  | T  |       TG        CG G  |       GC        CG TA       |  A       TA CG        CG        AT TG        TA        GT CG        GT        AT TA        CG        GC                         CTATTTTAGAGCTAAAGCGTATCCGTATAGGGAGTTTGGTTTTAGGAGGCTTGCGTTATGGCGAATATCGCGAGCTTACAGATGCGGAACTCGGGACCTACATGAAATTGTCTGACTAActtgtttttttatatactaacctgcaatagatagagccctATG     ..................................................................................................................