Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.91 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCTCGCTAAAGGAGATAAAGTCACTGCCATGGGAATCATCGGCACTGTTGACGAT
ATCCGTGAGCACACGGTAATTTTAAATATTGCTTCTGGAAAAGTAGAAGTTTTAAAAG
GAGCTATTTCTGAAATCCTCAAGCCTAACGATAACAAATCATAAggaatttcttttgagactttcat
cccacgattaaaatcgtgggatttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagt
ctgggatttttatcgttATG

    nqr6


Gene: nqr6     GI: 15618792     BI number: CPn0883     GOG: COG2871     Description: Phenolhydrolase/NADH ubiquinone oxidoreductase


            C
          A  A
          A  A
           TA
           AT
           GC
          C  A
          A  T
          A  A
           TA
           Cg
           Cg
          |  a
          |  a
          |  t
          |  t
          |  t
          |  c
          |  t
           Gt
           At
 AA        At        aa
A  A       Cg       t  a
 TG        Ta        ta
 TG        Cg        at
 TA       C  a       gc
 TG       T  c       cg
 GC        At        at
 AT        At        cg
|  A       At        cg
|  T       Gc        cg
|  T       Ta        ta
 AT       C  |       at
 GC       T  |      c  t
 AT       T  |      t  |
 TG       T  |      t  |
G  A      A  |      t  |
A  A      T  |      c  |
A  A      C  |       at
A  |      G  |       gc
 AT        At        at
 GC        Gc        gt
 GC        Gc        ta
                        tttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagtctgggatttttatcgttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2871 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.91 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -8.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCTCGCTAAAGGAGATAAAGTCACTGCCATGGGAATCATCGGCACTGTTGACGAT
ATCCGTGAGCACACGGTAATTTTAAATATTGCTTCTGGAAAAGTAGAAGTTTTAAAAG
GAGCTATTTCTGAAATCCTCAAGCCTAACGATAACAAATCATAAggaatttcttttgagactttcat
cccacgattaaaatcgtgggatttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagt
ctgggatttttatcgttATG

    nqr6


Gene: nqr6     GI: 15618792     BI number: CPn0883     GOG: COG2871     Description: Phenolhydrolase/NADH ubiquinone oxidoreductase


            c
          t  a
          t  t
           tc
           cc
           ac
          g  a
          a  c
          g  g
           ta
           tt
  C        tt
A  A      |  a
A  A      |  a
 TA       |  a
 AT       |
 GC       |
C  A      |
A  T      |
A  A       t
 TA        c
 Cg        t
 Cg        t
|  a       t
|  a       a
|  t      a
|  t      g
|  t       g
|  c       A
|  t       A
 Gt        T
 At        A
 At       C  |       aa
 Cg       T  |      t  a
 Ta       A  |       ta
 Cg       A  |       at
C  a      A  |       gc
T  c      C  |       cg
 At       A  |       at
 At       A  |       cg
 At        T        cg
 Gc        A        cg
 Ta        G        ta
                        tttcttatttattgtcttaaggtttattgcttttttatgcgctaagttataatttgactctatgagcttttcataaagtctgggatttttatcgttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG2871 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF ... can be seen here

    ..................................................................................................................