                                                                        Gene putatively regulated by attenuation in C_pneumoniae_CWL029

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCGGCCTTACCGCTTGGCTATGCCACCaaaggggaggatgagaatccttagtttaagcgaaagaagattttatggta
agcgagaagtgcgcataattctagagactagggaaatcttagtcgtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatca
acctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccat
agatgctgtaggcaaaattatATG

    murF --- mraY --- murD --- nlpD --- ftsW --- murG --- murC/ddlA Gene: murF     GI: 15618808     BI number: CPn0899     GOG: COG0770     Description: Muramoyl-DAP Ligase Gene: mraY     GI: 15618809     BI number: CPn0900     GOG: COG0472     Description: Muramoyl-Pentapeptide Transferase Gene: murD     GI: 15618810     BI number: CPn0901     GOG: COG0771     Description: Muramoylalanine-Glutamate Ligase Gene: nlpD     GI: 15618811     BI number: CPn0902     GOG: COG1388     Description: Muramidase (invasin repeat family) Gene: ftsW     GI: 15618812     BI number: CPn0903     GOG: COG0772     Description: Cell Division Protein FtsW Gene: murG     GI: 15618813     BI number: CPn0904     GOG: COG0707     Description: Peptidoglycan Transferase Gene: murC/ddlA     GI: 15618814     BI number: CPn0905     GOG: COG0773,COG1181     Description: Muramate-Ala Ligase & D-Ala-D-Ala Ligas ag g  a ta at gc gc at gt |  a |  g |  t |  t |  t |  a |  a |  g |  c |  g |  a |  a |  a |  g |  a g  a g  g g  a       gc at       c  a at       g  t at       t  a C  t      g  a C  a       at At        at Cg        gc Cg        at Gt       g  a Ta       c  g A  |      g  a Ta       a  g Cg       a  |        a Gc        ta       a  a |  g       gc       g  t |  a       gt        gc G  g       ta        gt Ta       a  g       at Ta       t  g       ta Cg        tg        cg Gt        ta        at Cg        ta        gc                         gtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatcaacctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccatagatgctgtaggcaaaattatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0770 UDP-N-acetylmuramyl pentapeptide synthase ... can be seen here [M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here [M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here [M] COG1388 FOG: LysM repeat ... can be seen here [D] COG0772 Bacterial cell division membrane protein ... can be seen here [M] COG0707 UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase ... can be seen here [M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................